• 글쓰기
• 목록

Nd the Kunitz domain. Removal of the signal peptide gives rise to a secreted protein of 9.1 kDa. The human and mouse transcripts differ with respect to the splicing of the second exon, which is only nine nucleotides in the mouse and codes for three amino3 C1 FD W 0 C1 BFD W CClauss et al. BMC Biochemistry 2011, 12:55 http://www.biomedcentral.com/1471-2091/12/Page 4 ofAM Q L Q A S L S F L L I L T L C L E L R S E L A R CTGGCTGAGTGGCACCATGCAGCTTCAGGCCTCTCTCTCGTTTCTCCTGATTCTCACTCTCTGCCTAGAGCTTCGATCAGAACTAGCACG D T I K D L L P N V C A F P M E K G P C Q T Y M T R W F F N AGACACTATCAAGGATCTCCTCCCAAATGTATGCGCTTTTCCTATGGAAAAGGGCCCTTGTCAAACCTACATGACGCGATGGTTTTTCAA F E T G E C E L F A Y G G C G G N S N N F L R K E K C E K F CTTTGAAACTGGTGAATGTGAGTTATTTGCTTACGGAGGCTGCGGAGGCAACAGCAACAACTTTTTGAGGAAAGAAAAATGTGAGAAATT C K F T CTGCAAGTTCACCTGATTTTCTAACAAGAACACAGCCCTCCATGGATTCGGGATTGCTCTGAGGGCCATAGAAGGCATTTGCGTGTGTGT GTGTGTGTGAACAAGAGGTTCATTCCTCTACCCCCACATTTATTCTCCCTGATGTGCTCCTACAAGTGCTTCATCTCTGTGCCTGAAATT CTATAAATGTTGCAATCATGBM K S A K L G F L L R F F I F C S L N T L L L G GCCTGCTGCTTGCTGCACCATGAAGTCTGCCAAGCTGGGATTTCTTCTAAGATTCTTCATCTTCTGCTCATTGAATACCCTGTTATTGGG G V N K I A E K I C G D L K D P C K L D M N F G S C Y E V H TGGTGTTAATAAAATTGCGGAGAAGATATGTGGAGACCTCAAAGATCCCTGCAAATTGGACATGAATTTTGGAAGCTGCTATGAAGTTCA F R PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/8086425 Y F Y N R T S K R C E T F V F S G C N G N L N N F K L K CTTTAGATATTTCTACAACAGAACCTCCAAAAGATGTGAAACTTTTGTCTTCTCCGGCTGTAATGGCAACCTTAACAACTTCAAGCTTAA I E R E V A C V A K Y K P P R AATAGAACGTGAAGTAGCCTGTGTTGCAAAATACAAACCACCGAGGTGAGAGGATGTGAACTCATGAAGTTGTCTGCTGCACCATCCGAA ATAAAGACACAAGAAAATTCAGACTGATTTTGAAAATCTTTGTAATATTTCCATAATGCTTTAAGCTTCCATATGTTTGCTATTTTCCTG ACCCTAGTTTTGCCTTTCCTGGAAATTAACTGTATGATCATTAGAATGAAAGAGTCTTTCTGTCFigure 2 Structure of SPINT3 and SPINT4. The nucleotide sequences of transcripts are given with translation written above for (A) SPINT3 and (B) SPINT4. The arrows indicate location of the predicted signal peptide cleavage sites. The two Cys in SPINT4, which might form an unconventional disulphide bond, are boxed. The nucleotides present in the longer SPINT4 transcript, but not in the shorter, are italicized.acid residues. The splice acceptor site of the mouse transcript is structurally conserved in the human genome and, if used, it could generate a translation product encompassing both a signal peptide and a secreted protein of 9.7 kDa with a Kunitz domain (Figure 3). The RACE procedure also yielded products for alternative 5' and 3' ends of human SPINT5. The sequence of a shorter 5' RACE product overlaps with the human transcript that is orthologous with mouse Spint5, but starts three nucleotides downstream of the splice acceptor site of the second exon (Figure 3). This transcript could potentially generate an intracellular Kunitz domain, as it is lacking the coding information of the signal peptide. The alternative 3' end is longer and derived from 5 exons located 3' 3-Chloro-5-cyclopropylpyridine to the exon with the Kunitz motif.Expression of transcripts in normal human tissuesGene expression was analyzed by RT-PCR using RNA from a panel of 26 tissue specimens that previously PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/25116583 had been screened for genes encoding WFDC domains [14]. Tissues that generated PCR 3-(2,4-Dichlorophenoxy)azetidine products with the correct size of spliced transcripts were taken to quantitative analysis using real time PCR. The housekeeping genes CSTB and APRT, which were used for normalization of the PCR data, generated transcripts with meltingtemperatures of 80 and 81.5 and yielded Ct values in the range of.